Быстрый заказ

Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus MS4A1 Информация о продукте «Клон cDNA»
Размер кДНК:894bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) membrane-spanning 4-domains, subfamily A, member 1 with C terminal Myc tag.
Синоним гена:MS4A1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90052-ACGRBS15400
Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90052-ACRRBS15400
Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90052-CFRBS13340
Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90052-CHRBS13340
Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90052-CMRBS13340
Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90052-CYRBS13340
Резус-фактор CD20/MS4A1 Джин клон кДНК в вектор клонированияCG90052-GRBS5130
Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90052-NFRBS13340
Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90052-NHRBS13340
Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90052-NMRBS13340
Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90052-NYRBS13340
Резус-фактор CD20/MS4A1 Джин ORF экспрессии кДНК клона плазмидыCG90052-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. CD20 / MS4A1 is expressed on all stages of B cell development except the first and last. CD20 / MS4A1 is present from pre-pre B cells through memory cells, but not on either pro-B cells or plasma cells. It is a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. CD20 / MS4A1may be involved in the regulation of B-cell activation and proliferation. Defects in CD20 / MS4A1 are the cause of immunodeficiency common variable type 5(CVID5). CVID5 is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The defect results from a failure of B-cell differentiation and impaired secretion of immunoglobulins; the numbers of circulating B-cells is usually in the normal range, but can be low.

  • Tedder TF, et al. (1988) Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes. Proc Natl Acad Sci. 85(1): 208-12.
  • Cragg MS, et al. (2005) The biology of CD20 and its potential as a target for mAb therapy. Curr Dir Autoimmun. 8: 140-74..
  • Polyak MJ, et al. (2003) A cholesterol-dependent CD20 epitope detected by the FMC7 antibody. Leukemia. 17(7): 1384-9.
  • Size / Price
    Каталог: CG90052-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.