Быстрый заказ

Text Size:AAA

Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus MORF4L2 Информация о продукте «Клон cDNA»
Размер кДНК:867bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) Mortality factor 4-like protein 2 with N terminal HA tag.
Синоним гена:MORF4L2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90404-ACGRBS15400
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90404-ACRRBS15400
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90404-ANGRBS15400
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90404-ANRRBS15400
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90404-CFRBS13340
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90404-CHRBS13340
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90404-CMRBS13340
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90404-CYRBS13340
Яванский макак MORF4L2 Джин клон кДНК в вектор клонированияCG90404-GRBS5130
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90404-NFRBS13340
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90404-NHRBS13340
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90404-NMRBS13340
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90404-NYRBS13340
Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмидыCG90404-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90404-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.