Быстрый заказ

Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак MORF4L2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001283369.1
    Размер кДНК:867bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) Mortality factor 4-like protein 2 with C terminal HA tag.
    Синоним гена:MORF4L2
    Виды:Cynomolgus
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90404-ACGRBS15400
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90404-ACRRBS15400
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90404-ANGRBS15400
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90404-ANRRBS15400
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90404-CFRBS13340
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90404-CHRBS13340
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90404-CMRBS13340
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90404-CYRBS13340
    Яванский макак MORF4L2 Джин клон кДНК в вектор клонированияCG90404-GRBS5130
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90404-NFRBS13340
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90404-NHRBS13340
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90404-NMRBS13340
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90404-NYRBS13340
    Яванский макак MORF4L2 Джин ORF экспрессии кДНК клона плазмидыCG90404-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90404-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».