MCRS1 cDNA ORF Clone, Cynomolgus, N-His tag

Cat: CG90470-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MCRS1 Reagents

CRO Services

Product recommended


All MCRS1 Reagents

MCRS1 cDNA ORF Clone, Cynomolgus, N-His tag General Information

Gene

Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1389 bp
Description
Full length Clone DNA of Cynomolgus microspherule protein 1 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MCRS1 Background Information

Full Name
microspherule protein 1

MCRS1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
MCRS1 cDNA ORF Clone in Cloning Vector, Ferret FG60058-G
MCRS1 cDNA ORF Clone, Ferret, untagged FG60058-UT
MCRS1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60058-ACGLN
MCRS1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60058-ACG
MCRS1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60058-ANG
MCRS1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60058-ACR
MCRS1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60058-ANR
MCRS1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60058-CF
MCRS1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60058-NF
MCRS1 cDNA ORF Clone, Ferret, C-His tag FG60058-CH
MCRS1 cDNA ORF Clone, Ferret, N-His tag FG60058-NH
MCRS1 cDNA ORF Clone, Ferret, C-HA tag FG60058-CY
MCRS1 cDNA ORF Clone, Ferret, N-HA tag FG60058-NY
MCRS1 cDNA ORF Clone, Ferret, C-Myc tag FG60058-CM
MCRS1 cDNA ORF Clone, Ferret, N-Myc tag FG60058-NM

MCRS1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
MCRS1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90470-G
MCRS1 cDNA ORF Clone, Cynomolgus, untagged CG90470-UT
MCRS1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90470-ACGLN
MCRS1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90470-ACG
MCRS1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90470-ANG
MCRS1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90470-ACR
MCRS1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90470-ANR
MCRS1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90470-CF
MCRS1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90470-NF
MCRS1 cDNA ORF Clone, Cynomolgus, C-His tag CG90470-CH
MCRS1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90470-CY
MCRS1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90470-NY
MCRS1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90470-CM
MCRS1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90470-NM

MCRS1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MCRS1 cDNA ORF Clone in Cloning Vector, Rat RG81091-U
MCRS1 cDNA ORF Clone, Rat, untagged RG81091-UT
MCRS1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81091-ACG
MCRS1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81091-ACGLN
MCRS1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81091-ANG
MCRS1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81091-ACR
MCRS1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81091-ANR
MCRS1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81091-CF
MCRS1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81091-NF
MCRS1 cDNA ORF Clone, Rat, C-His tag RG81091-CH
MCRS1 cDNA ORF Clone, Rat, N-His tag RG81091-NH
MCRS1 cDNA ORF Clone, Rat, C-HA tag RG81091-CY
MCRS1 cDNA ORF Clone, Rat, N-HA tag RG81091-NY
MCRS1 cDNA ORF Clone, Rat, C-Myc tag RG81091-CM
MCRS1 cDNA ORF Clone, Rat, N-Myc tag RG81091-NM
MCRS1 qPCR Primer Pairs, Rat RP301048

MCRS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MCRS1 cDNA ORF Clone in Cloning Vector, Mouse MG53924-U
MCRS1 cDNA ORF Clone, Mouse, untagged MG53924-UT
MCRS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53924-ACG
MCRS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53924-ACGLN
MCRS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53924-ANG
MCRS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53924-ACR
MCRS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53924-ANR
MCRS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53924-CF
MCRS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53924-NF
MCRS1 cDNA ORF Clone, Mouse, C-His tag MG53924-CH
MCRS1 cDNA ORF Clone, Mouse, N-His tag MG53924-NH
MCRS1 cDNA ORF Clone, Mouse, C-HA tag MG53924-CY
MCRS1 cDNA ORF Clone, Mouse, N-HA tag MG53924-NY
MCRS1 cDNA ORF Clone, Mouse, C-Myc tag MG53924-CM
MCRS1 cDNA ORF Clone, Mouse, N-Myc tag MG53924-NM

MCRS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MCRS1 cDNA ORF Clone in Cloning Vector, Human HG14816-G
MCRS1 cDNA ORF Clone, Human, untagged HG14816-UT
MCRS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14816-ACG
MCRS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14816-ACGLN
MCRS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14816-ANG
MCRS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14816-ACR
MCRS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14816-ANR
MCRS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14816-CF
MCRS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14816-NF
MCRS1 cDNA ORF Clone, Human, C-His tag HG14816-CH
MCRS1 cDNA ORF Clone, Human, N-His tag HG14816-NH
MCRS1 cDNA ORF Clone, Human, C-HA tag HG14816-G-Y
MCRS1 cDNA ORF Clone, Human, C-HA tag HG14816-CY
MCRS1 cDNA ORF Clone, Human, N-HA tag HG14816-NY
MCRS1 cDNA ORF Clone, Human, C-Myc tag HG14816-CM
MCRS1 cDNA ORF Clone, Human, N-Myc tag HG14816-NM
MCRS1 qPCR Primer Pairs, Human HP103448
info info
添加购物车成功! 添加购物车失败!