Быстрый заказ

Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак MAT2A Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005575421.1
    Размер кДНК:1188bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101865874.
    Синоним гена:MAT2A
    Виды:Cynomolgus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90747-ACGRBS15400
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90747-ACRRBS15400
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90747-ANGRBS15400
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90747-ANRRBS15400
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90747-CFRBS13340
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90747-CHRBS13340
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90747-CMRBS13340
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90747-CYRBS13340
    Яванский макак MAT2A Джин клон кДНК в вектор клонированияCG90747-GRBS5130
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90747-NFRBS13340
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90747-NHRBS13340
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90747-NMRBS13340
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90747-NYRBS13340
    Яванский макак MAT2A Джин ORF экспрессии кДНК клона плазмидыCG90747-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90747-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».