After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак LOXL2/Lysyl oxidase-like 2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOXL2 Информация о продукте «Клон cDNA»
Размер кДНК:2325bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis lysyl oxidase-like 2 with C terminal His tag.
Синоним гена:LOXL2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Lysyl oxidase homolog 2, also known as Lysyl oxidase-like protein 2, Lysyl oxidase-related protein 2, Lysyl oxidase-related protein WS9-14 and LOXL2, is a secreted protein which belongs to the lysyl oxidase family. LOXL2 contains four SRCR domains. The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1-4 ( LOXL1, LOXL2, LOXL3, LOXL4 ). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation. LOXL2 expression could also be explored as a molecular target in the prevention of breast cancer progression.

  • Peng,L. et al., 2009, Carcinogenesis. 30 (10):1660-9.
  • Hollosi,P. et al., 2009, Int J Cancer. 125 (2):318-27.
  • Rückert,F. et al., 2010, Int J Colorectal Dis. 25 (3):303-11.
  • Iftikhar,M. et al., 2011, J Biol Chem. 286 (2):909-18.
  • Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.