Быстрый заказ

Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак LOC709646 Информация о продукте «Клон cDNA»
    Размер кДНК:549bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) vacuolar protein sorting-associated protein 29-like with N terminal HA tag.
    Синоним гена:LOC709646
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90417-ACGRBS22240
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90417-ACRRBS22240
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90417-ANGRBS22240
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90417-ANRRBS22240
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90417-CFRBS20190
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90417-CHRBS20190
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90417-CMRBS20190
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90417-CYRBS20190
    Резус-фактор LOC709646 Джин клон кДНК в вектор клонированияCG90417-GRBS5130
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90417-NFRBS20190
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90417-NHRBS20190
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90417-NMRBS20190
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90417-NYRBS20190
    Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмидыCG90417-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90417-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.