After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC709646 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001107873.1
Размер кДНК:549bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) vacuolar protein sorting-associated protein 29-like with N terminal HA tag.
Синоним гена:LOC709646
Виды:Rhesus
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90417-ACGRBS15400
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90417-ACRRBS15400
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90417-ANGRBS15400
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90417-ANRRBS15400
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90417-CFRBS13340
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90417-CHRBS13340
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90417-CMRBS13340
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90417-CYRBS13340
Резус-фактор LOC709646 Джин клон кДНК в вектор клонированияCG90417-GRBS5130
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90417-NFRBS13340
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90417-NHRBS13340
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90417-NMRBS13340
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90417-NYRBS13340
Резус-фактор LOC709646 Джин ORF экспрессии кДНК клона плазмидыCG90417-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90417-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».