Быстрый заказ

Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак LOC701810 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_001096089.1
    Размер кДНК:687bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) BTB/POZ domain-containing protein KCTD6-like.
    Синоним гена:LOC701810
    Виды:Rhesus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90744-ACGRBS22240
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90744-ACRRBS22240
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90744-ANGRBS22240
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90744-ANRRBS22240
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90744-CFRBS20190
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90744-CHRBS20190
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90744-CMRBS20190
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90744-CYRBS20190
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин клон кДНК в вектор клонированияCG90744-GRBS5130
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90744-NFRBS20190
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90744-NHRBS20190
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90744-NMRBS20190
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90744-NYRBS20190
    Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмидыCG90744-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90744-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».