After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC701810 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001096089.1
Размер кДНК:687bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) BTB/POZ domain-containing protein KCTD6-like.
Синоним гена:LOC701810
Виды:Rhesus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды on other vectors
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90744-ACGRBS15400
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90744-ACRRBS15400
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90744-ANGRBS15400
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90744-ANRRBS15400
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90744-CFRBS13340
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90744-CHRBS13340
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90744-CMRBS13340
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90744-CYRBS13340
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин клон кДНК в вектор клонированияCG90744-GRBS5130
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90744-NFRBS13340
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90744-NHRBS13340
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90744-NMRBS13340
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90744-NYRBS13340
Резус-фактор BTB/POZ domain-containing Белок KCTD6-like Джин ORF экспрессии кДНК клона плазмидыCG90744-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90744-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».