After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC102130495 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005555538.1
Размер кДНК:387bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) histone H2A.Z-like.
Синоним гена:LOC102130495
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90727-ACGRBS15400
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90727-ACRRBS15400
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90727-ANGRBS15400
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90727-ANRRBS15400
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90727-CFRBS13340
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90727-CHRBS13340
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90727-CMRBS13340
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90727-CYRBS13340
Яванский макак histone H2A.Z-like Джин клон кДНК в вектор клонированияCG90727-GRBS5130
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90727-NFRBS13340
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90727-NHRBS13340
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90727-NMRBS13340
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90727-NYRBS13340
Яванский макак histone H2A.Z-like Джин ORF экспрессии кДНК клона плазмидыCG90727-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90727-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».