After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC102130101 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001284821.1
Размер кДНК:306bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) small ubiquitin-related modifier 1-like.
Синоним гена:LOC102130101
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90733-ACGRBS15400
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90733-ACRRBS15400
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90733-ANGRBS15400
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90733-ANRRBS15400
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90733-CFRBS13340
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90733-CHRBS13340
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90733-CMRBS13340
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90733-CYRBS13340
Яванский макак small ubiquitin-related modifier 1-like Джин клон кДНК в вектор клонированияCG90733-GRBS5130
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90733-NFRBS13340
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90733-NHRBS13340
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90733-NMRBS13340
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90733-NYRBS13340
Яванский макак small ubiquitin-related modifier 1-like Джин ORF экспрессии кДНК клона плазмидыCG90733-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90733-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».