Быстрый заказ

Text Size:AAA

Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC102124736 Информация о продукте «Клон cDNA»
Размер кДНК:687bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) transcription elongation factor A protein-like 2-like with C terminal His tag.
Синоним гена:LOC102124736
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90351-ACGRBS15396
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90351-ACRRBS15396
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90351-ANGRBS15396
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90351-ANRRBS15396
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90351-CFRBS13343
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90351-CHRBS13343
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90351-CMRBS13343
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90351-CYRBS13343
Яванский макак TCEAL2-Like Джин клон кДНК в вектор клонированияCG90351-GRBS5132
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90351-NFRBS13343
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90351-NHRBS13343
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90351-NMRBS13343
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90351-NYRBS13343
Яванский макак TCEAL2-Like Джин ORF экспрессии кДНК клона плазмидыCG90351-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90351-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.