After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC101926831 Информация о продукте «Клон cDNA»
Размер кДНК:1179bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101926831 with C terminal His tag.
Синоним гена:LOC101926831
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90835-ACGRBS15400
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90835-ACRRBS15400
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90835-ANGRBS15400
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90835-ANRRBS15400
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90835-CFRBS13340
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90835-CHRBS13340
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90835-CMRBS13340
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90835-CYRBS13340
Яванский макак LOC101926831 Джин клон кДНК в вектор клонированияCG90835-GRBS5130
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90835-NFRBS13340
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90835-NHRBS13340
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90835-NMRBS13340
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90835-NYRBS13340
Яванский макак LOC101926831 Джин ORF экспрессии кДНК клона плазмидыCG90835-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90835-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.