Быстрый заказ

Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак LOC101926331 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001284865.1
    Размер кДНК:513bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) hypothetical protein.
    Синоним гена:LOC101926331
    Виды:Cynomolgus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90754-ACGRBS22240
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90754-ACRRBS22240
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90754-ANGRBS22240
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90754-ANRRBS22240
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90754-CFRBS20190
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90754-CHRBS20190
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90754-CMRBS20190
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90754-CYRBS20190
    Яванский макак LOC101926331 Джин клон кДНК в вектор клонированияCG90754-GRBS5130
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90754-NFRBS20190
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90754-NHRBS20190
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90754-NMRBS20190
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90754-NYRBS20190
    Яванский макак LOC101926331 Джин ORF экспрессии кДНК клона плазмидыCG90754-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90754-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».