After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC101926233 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001283736.1
Размер кДНК:621bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101926233.
Синоним гена:LOC101926233
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90715-ACGRBS15400
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90715-ACRRBS15400
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90715-ANGRBS15400
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90715-ANRRBS15400
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90715-CFRBS13340
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90715-CHRBS13340
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90715-CMRBS13340
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90715-CYRBS13340
Яванский макак LOC101926233 Джин клон кДНК в вектор клонированияCG90715-GRBS5130
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90715-NFRBS13340
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90715-NHRBS13340
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90715-NMRBS13340
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90715-NYRBS13340
Яванский макак LOC101926233 Джин ORF экспрессии кДНК клона плазмидыCG90715-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».