Быстрый заказ

Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак LOC101925878 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005558311.1
    Размер кДНК:912bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) hypothetical protein.
    Синоним гена:LOC101925878
    Виды:Cynomolgus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90773-ACGRBS22240
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90773-ACRRBS22240
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90773-CFRBS20190
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90773-CHRBS20190
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90773-CMRBS20190
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90773-CYRBS20190
    Яванский макак LOC101925878 Джин клон кДНК в вектор клонированияCG90773-GRBS5130
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90773-NFRBS20190
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90773-NHRBS20190
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90773-NMRBS20190
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90773-NYRBS20190
    Яванский макак LOC101925878 Джин ORF экспрессии кДНК клона плазмидыCG90773-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90773-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».