After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC101925858 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AB169268.1
Размер кДНК:819bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101925858 with C terminal HA tag.
Синоним гена:LOC101925858
Виды:Cynomolgus
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90837-ACGRBS15400
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90837-ACRRBS15400
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90837-ANGRBS15400
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90837-ANRRBS15400
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90837-CFRBS13340
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90837-CHRBS13340
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90837-CMRBS13340
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90837-CYRBS13340
Яванский макак LOC101925858 Джин клон кДНК в вектор клонированияCG90837-GRBS5130
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90837-NFRBS13340
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90837-NHRBS13340
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90837-NMRBS13340
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90837-NYRBS13340
Яванский макак LOC101925858 Джин ORF экспрессии кДНК клона плазмидыCG90837-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».