After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC101925475 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001283817.1
Размер кДНК:918bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101925475.
Синоним гена:LOC101925475
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90756-ACGRBS15400
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90756-ACRRBS15400
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90756-ANGRBS15400
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90756-ANRRBS15400
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90756-CFRBS13340
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90756-CHRBS13340
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90756-CMRBS13340
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90756-CYRBS13340
Яванский макак LOC101925475 Джин клон кДНК в вектор клонированияCG90756-GRBS5130
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90756-NFRBS13340
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90756-NHRBS13340
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90756-NMRBS13340
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90756-NYRBS13340
Яванский макак LOC101925475 Джин ORF экспрессии кДНК клона плазмидыCG90756-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90756-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».