After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC101925419 Информация о продукте «Клон cDNA»
Размер кДНК:765bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101925419 with C terminal His tag.
Синоним гена:LOC101925419
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90831-ACGRBS15400
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90831-ACRRBS15400
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90831-ANGRBS15400
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90831-ANRRBS15400
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90831-CFRBS13340
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90831-CHRBS13340
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90831-CMRBS13340
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90831-CYRBS13340
Яванский макак LOC101925419 Джин клон кДНК в вектор клонированияCG90831-GRBS5130
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90831-NFRBS13340
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90831-NHRBS13340
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90831-NMRBS13340
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90831-NYRBS13340
Яванский макак LOC101925419 Джин ORF экспрессии кДНК клона плазмидыCG90831-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90831-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.