After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC101925366 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005551280.1
Размер кДНК:3252bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101925366 with C terminal His tag.
Синоним гена:LOC101925366
Виды:Cynomolgus
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90840-ACGRBS22240
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90840-ACRRBS22240
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90840-ANGRBS22240
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90840-ANRRBS22240
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90840-CFRBS20190
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90840-CHRBS20190
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90840-CMRBS20190
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90840-CYRBS20190
Яванский макак LOC101925366 Джин клон кДНК в вектор клонированияCG90840-GRBS5130
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90840-NFRBS20190
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90840-NHRBS20190
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90840-NMRBS20190
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90840-NYRBS20190
Яванский макак LOC101925366 Джин ORF экспрессии кДНК клона плазмидыCG90840-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90840-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».