PGD cDNA ORF Clone, Cynomolgus, N-His tag

Price:
Size:
Number:

PGD cDNA ORF Clone, Cynomolgus, N-His tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1413 bp
Description
Full length Clone DNA of Cynomolgus uncharacterized LOC101866917 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PGD Background Information

Full Name
phosphogluconate dehydrogenase
References
  • Baillet A, et al. (2011) Coupling of 6-phosphogluconate dehydrogenase with NADPH oxidase in neutrophils: Nox2 activity regulation by NADPH availability. FASEB J. 25(7): 2333-43.
  • Rho HK, et al. (2005) Transcriptional regulation of mouse 6-phosphogluconate dehydrogenase by ADD1/SREBP1c. Biochem Biophys Res Commun. 332(1): 288-96.
  • Broedel SE, et al. (1990). Genetic tagging, cloning, and DNA sequence of the Synechococcus sp. strain PCC 7942 gene (gnd) encoding 6-phosphogluconate dehydrogenase. J Bacteriol. 172 (7): 4023-31.
  • Adams MJ, et al. (1983). The three dimensional structure of sheep liver 6-phosphogluconate dehydrogenase at 2.6 A resolution. EMBO J. 2 (6): 1009-14.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait