Быстрый заказ

Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак LOC101866559 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005539922.1
    Размер кДНК:1131bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101866559.
    Синоним гена:LOC101866559
    Виды:Cynomolgus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90759-ACGRBS22240
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90759-ACRRBS22240
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90759-ANGRBS22240
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90759-ANRRBS22240
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90759-CFRBS20190
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90759-CHRBS20190
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90759-CMRBS20190
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90759-CYRBS20190
    Яванский макак LOC101866559 Джин клон кДНК в вектор клонированияCG90759-GRBS5130
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90759-NFRBS20190
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90759-NHRBS20190
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90759-NMRBS20190
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90759-NYRBS20190
    Яванский макак LOC101866559 Джин ORF экспрессии кДНК клона плазмидыCG90759-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90759-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».