Быстрый заказ

Text Size:AAA

Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC101866434 Информация о продукте «Клон cDNA»
Размер кДНК:774bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101866434 with C terminal HA tag.
Синоним гена:LOC101866434
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90834-ACGRBS15396
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90834-ACRRBS15396
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90834-ANGRBS15396
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90834-ANRRBS15396
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90834-CFRBS13343
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90834-CHRBS13343
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90834-CMRBS13343
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90834-CYRBS13343
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90834-NFRBS13343
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90834-NHRBS13343
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90834-NMRBS13343
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90834-NYRBS13343
Яванский макак LOC101866434 Джин клон кДНК в вектор клонированияCG90834-URBS5132
Яванский макак LOC101866434 Джин ORF экспрессии кДНК клона плазмидыCG90834-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90834-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.