Быстрый заказ

Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак LOC101866405 Информация о продукте «Клон cDNA»
    Размер кДНК:375bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) hypothetical protein with N terminal Myc tag.
    Синоним гена:LOC101866405
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90810-ACGRBS22240
    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90810-ACRRBS22240
    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90810-CFRBS20190
    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90810-CHRBS20190
    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90810-CMRBS20190
    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90810-CYRBS20190
    Яванский макак LOC101866405 Джин клон кДНК в вектор клонированияCG90810-GRBS5130
    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90810-NFRBS20190
    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90810-NHRBS20190
    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90810-NMRBS20190
    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90810-NYRBS20190
    Яванский макак LOC101866405 Джин ORF экспрессии кДНК клона плазмидыCG90810-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90810-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.