After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC101866337 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001283801.1
Размер кДНК:750bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101866337 with N terminal HA tag.
Синоним гена:LOC101866337
Виды:Cynomolgus
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90419-ACGRBS15400
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90419-ACRRBS15400
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90419-ANGRBS15400
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90419-ANRRBS15400
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90419-CFRBS13340
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90419-CHRBS13340
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90419-CMRBS13340
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90419-CYRBS13340
Яванский макак LOC101866337 Джин клон кДНК в вектор клонированияCG90419-GRBS5130
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90419-NFRBS13340
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90419-NHRBS13340
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90419-NMRBS13340
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90419-NYRBS13340
Яванский макак LOC101866337 Джин ORF экспрессии кДНК клона плазмидыCG90419-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90419-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».