After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC101865981 Информация о продукте «Клон cDNA»
Размер кДНК:2154bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101865981 with N terminal Myc tag.
Синоним гена:LOC101865981
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90647-ACGRBS16764
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90647-ACRRBS16764
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90647-ANGRBS16764
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90647-ANRRBS16764
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90647-CFRBS14711
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90647-CHRBS14711
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90647-CMRBS14711
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90647-CYRBS14711
Яванский макак LOC101865981 Джин клон кДНК в вектор клонированияCG90647-GRBS5132
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90647-NFRBS14711
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90647-NHRBS14711
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90647-NMRBS14711
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90647-NYRBS14711
Яванский макак LOC101865981 Джин ORF экспрессии кДНК клона плазмидыCG90647-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90647-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.