Быстрый заказ

Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак LOC101865627 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001284612.1
    Размер кДНК:885bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101865627.
    Синоним гена:LOC101865627
    Виды:Cynomolgus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90765-ACGRBS22240
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90765-ACRRBS22240
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90765-ANGRBS22240
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90765-ANRRBS22240
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90765-CFRBS20190
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90765-CHRBS20190
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90765-CMRBS20190
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90765-CYRBS20190
    Яванский макак LOC101865627 Джин клон кДНК в вектор клонированияCG90765-GRBS5130
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90765-NFRBS20190
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90765-NHRBS20190
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90765-NMRBS20190
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90765-NYRBS20190
    Яванский макак LOC101865627 Джин ORF экспрессии кДНК клона плазмидыCG90765-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90765-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».