Быстрый заказ

Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Яванский макак LOC101865604 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AB173255.1
Размер кДНК:300bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101865604 with N terminal His tag.
Синоним гена:LOC101865604
Виды:Cynomolgus
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90593-ACGRBS22240
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90593-ACRRBS22240
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90593-ANGRBS22240
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90593-ANRRBS22240
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90593-CFRBS20190
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90593-CHRBS20190
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90593-CMRBS20190
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90593-CYRBS20190
Яванский макак LOC101865604 Джин клон кДНК в вектор клонированияCG90593-GRBS5130
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90593-NFRBS20190
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90593-NHRBS20190
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90593-NMRBS20190
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90593-NYRBS20190
Яванский макак LOC101865604 Джин ORF экспрессии кДНК клона плазмидыCG90593-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90593-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».