Быстрый заказ

Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак LOC101865541 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005568574.1
    Размер кДНК:816bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101865541.
    Синоним гена:LOC101865541
    Виды:Cynomolgus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90737-ACGRBS22240
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90737-ACRRBS22240
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90737-ANGRBS22240
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90737-ANRRBS22240
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90737-CFRBS20190
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90737-CHRBS20190
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90737-CMRBS20190
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90737-CYRBS20190
    Яванский макак LOC101865541 Джин клон кДНК в вектор клонированияCG90737-GRBS5130
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90737-NFRBS20190
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90737-NHRBS20190
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90737-NMRBS20190
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90737-NYRBS20190
    Яванский макак LOC101865541 Джин ORF экспрессии кДНК клона плазмидыCG90737-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».