Быстрый заказ

Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак LOC101865472 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005580630.1
    Размер кДНК:1239bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101865472 with N terminal HA tag.
    Синоним гена:LOC101865472
    Виды:Cynomolgus
    переносчик:pCMV3-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90423-ACGRBS22240
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90423-ACRRBS22240
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90423-ANGRBS22240
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90423-ANRRBS22240
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90423-CFRBS20190
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90423-CHRBS20190
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90423-CMRBS20190
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90423-CYRBS20190
    Яванский макак LOC101865472 Джин клон кДНК в вектор клонированияCG90423-GRBS5130
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90423-NFRBS20190
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90423-NHRBS20190
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90423-NMRBS20190
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90423-NYRBS20190
    Яванский макак LOC101865472 Джин ORF экспрессии кДНК клона плазмидыCG90423-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90423-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».