After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC100428434 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_002798410.1
Размер кДНК:363bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) uncharacterized LOC100428434.
Синоним гена:LOC100428434
Виды:Rhesus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90716-ACGRBS15400
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90716-ACRRBS15400
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90716-ANGRBS15400
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90716-ANRRBS15400
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90716-CFRBS13340
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90716-CHRBS13340
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90716-CMRBS13340
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90716-CYRBS13340
Резус-фактор LOC100428434 Джин клон кДНК в вектор клонированияCG90716-GRBS5130
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90716-NFRBS13340
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90716-NHRBS13340
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90716-NMRBS13340
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90716-NYRBS13340
Резус-фактор LOC100428434 Джин ORF экспрессии кДНК клона плазмидыCG90716-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90716-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».