Быстрый заказ

Text Size:AAA

Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC100427448 Информация о продукте «Клон cDNA»
Размер кДНК:144bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) uncharacterized LOC100427448 with N terminal His tag.
Синоним гена:LOC100427448
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90604-ACGRBS15400
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90604-ACRRBS15400
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90604-ANGRBS15400
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90604-ANRRBS15400
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90604-CFRBS13340
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90604-CHRBS13340
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90604-CMRBS13340
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90604-CYRBS13340
Резус-фактор LOC100427448 Джин клон кДНК в вектор клонированияCG90604-GRBS5130
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90604-NFRBS13340
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90604-NHRBS13340
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90604-NMRBS13340
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90604-NYRBS13340
Резус-фактор LOC100427448 Джин ORF экспрессии кДНК клона плазмидыCG90604-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90604-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.