Быстрый заказ

Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Яванский макак LOC100426625 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_002804280.1
Размер кДНК:219bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) uncharacterized LOC100426625 with N terminal His tag.
Синоним гена:LOC100426625
Виды:Rhesus
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90597-ACGRBS22240
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90597-ACRRBS22240
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90597-ANGRBS22240
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90597-ANRRBS22240
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90597-CFRBS20190
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90597-CHRBS20190
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90597-CMRBS20190
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90597-CYRBS20190
Резус-фактор LOC100426625 Джин клон кДНК в вектор клонированияCG90597-GRBS5130
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90597-NFRBS20190
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90597-NHRBS20190
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90597-NMRBS20190
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90597-NYRBS20190
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмидыCG90597-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90597-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».