After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LOC100426625 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_002804280.1
Размер кДНК:219bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) uncharacterized LOC100426625 with N terminal His tag.
Синоним гена:LOC100426625
Виды:Rhesus
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90597-ACGRBS15400
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90597-ACRRBS15400
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90597-ANGRBS15400
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90597-ANRRBS15400
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90597-CFRBS13340
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90597-CHRBS13340
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90597-CMRBS13340
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90597-CYRBS13340
Резус-фактор LOC100426625 Джин клон кДНК в вектор клонированияCG90597-GRBS5130
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90597-NFRBS13340
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90597-NHRBS13340
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90597-NMRBS13340
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90597-NYRBS13340
Резус-фактор LOC100426625 Джин ORF экспрессии кДНК клона плазмидыCG90597-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90597-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».