Быстрый заказ

Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак LOC100425472 Информация о продукте «Клон cDNA»
    Размер кДНК:150bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) uncharacterized LOC100425472 with N terminal Myc tag.
    Синоним гена:LOC100425472
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90823-ACGRBS22240
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90823-ACRRBS22240
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90823-ANGRBS22240
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90823-ANRRBS22240
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90823-CFRBS20190
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90823-CHRBS20190
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90823-CMRBS20190
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90823-CYRBS20190
    Резус-фактор LOC100425472 Джин клон кДНК в вектор клонированияCG90823-GRBS5130
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90823-NFRBS20190
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90823-NHRBS20190
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90823-NMRBS20190
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90823-NYRBS20190
    Резус-фактор LOC100425472 Джин ORF экспрессии кДНК клона плазмидыCG90823-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90823-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.