Galectin 8 / LGALS8 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Price:
Size:
Number:

Galectin 8 / LGALS8 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
954 bp
Description
Full length Clone DNA of Rhesus lectin, galactoside-binding, soluble, 8 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Galectin 8 / LGALS8 Background Information

Full Name
lectin, galactoside-binding, soluble, 8
References
  • Levy Y, et al. (2003) Sustained induction of ERK, protein kinase B, and p70 S6 kinase regulates cell spreading and formation of F-actin microspikes upon ligation of integrins by galectin-8, a mammalian lectin. J Biol Chem. 278(16):14533-42.
  • Nishi N, et al. (2003) Galectin-8 modulates neutrophil function via interaction with integrin alphaM. Glycobiology. 13(11):755-63.
  • Bidon-Wagner N, et al. (2004) Human galectin-8 isoforms and cancer. Glycoconj J. 19(7-9):557-63.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait