After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LGALS8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001099600.2
Размер кДНК:954bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) lectin, galactoside-binding, soluble, 8 with C terminal Flag tag.
Синоним гена:LGALS8
Виды:Rhesus
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90167-ACGRBS15396
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90167-ACRRBS15396
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90167-ANGRBS15396
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90167-ANRRBS15396
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90167-CFRBS13343
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90167-CHRBS13343
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90167-CMRBS13343
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90167-CYRBS13343
Резус-фактор LGALS8 Джин клон кДНК в вектор клонированияCG90167-GRBS5132
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90167-NFRBS13343
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90167-NHRBS13343
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90167-NMRBS13343
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90167-NYRBS13343
Резус-фактор LGALS8 Джин ORF экспрессии кДНК клона плазмидыCG90167-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Levy Y, et al. (2003) Sustained induction of ERK, protein kinase B, and p70 S6 kinase regulates cell spreading and formation of F-actin microspikes upon ligation of integrins by galectin-8, a mammalian lectin. J Biol Chem. 278(16):14533-42.
  • Nishi N, et al. (2003) Galectin-8 modulates neutrophil function via interaction with integrin alphaM. Glycobiology. 13(11):755-63.
  • Bidon-Wagner N, et al. (2004) Human galectin-8 isoforms and cancer. Glycoconj J. 19(7-9):557-63.
  • Size / Price
    Каталог: CG90167-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».