After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LGALS3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001085890.2
Размер кДНК:747bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) lectin, galactoside-binding, soluble, 3 with C terminal Flag tag.
Синоним гена:LGALS3
Виды:Rhesus
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90166-ACGRBS15400
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90166-ACRRBS15400
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90166-ANGRBS15400
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90166-ANRRBS15400
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90166-CFRBS13340
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90166-CHRBS13340
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90166-CMRBS13340
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90166-CYRBS13340
Резус-фактор LGALS3 Джин клон кДНК в вектор клонированияCG90166-GRBS5130
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90166-NFRBS13340
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90166-NHRBS13340
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90166-NMRBS13340
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90166-NYRBS13340
Резус-фактор LGALS3 Джин ORF экспрессии кДНК клона плазмидыCG90166-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Dumic J, et al. (2006) Galectin-3: an open-ended story. Biochim Biophys Acta. 1760(4): 616-35.
  • Sharma UC, et al. (2004) Galectin-3 marks activated macrophages in failure-prone hypertrophied hearts and contributes to cardiac dysfunction. Circulation. 110(19): 3121-8.
  • Yan YP, et al. (2009) Galectin-3 mediates post-ischemic tissue remodeling. Brain Res. 1288: 116-24.
  • Size / Price
    Каталог: CG90166-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».