Быстрый заказ

Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LGALS1 Информация о продукте «Клон cDNA»
Размер кДНК:408bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) lectin, galactoside-binding, soluble, 1 with C terminal Flag tag.
Синоним гена:LGALS1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90161-ACGRBS15400
Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90161-ACRRBS15400
Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90161-CFRBS13340
Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90161-CHRBS13340
Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90161-CMRBS13340
Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90161-CYRBS13340
Резус-фактор Galectin-1/LGALS1 Джин клон кДНК в вектор клонированияCG90161-GRBS5130
Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90161-NFRBS13340
Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90161-NHRBS13340
Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90161-NMRBS13340
Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90161-NYRBS13340
Резус-фактор Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмидыCG90161-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Galectin-1 (Gal-1, GAL1), is a member of the galectins, a family of animal lectins ranging from Caenorhabditis elegans to humans, which is defined by their affinity for beta-galactosides and by significant sequence similarity in the carbohydrate-binding site. It is a homodimer with a subunit molecular mass of 14.5 kDa, which contains six cysteine residues per subunit. The cysteine residues should be in a free state in order to maintain a molecular structure that is capable of showing lectin activity. This endogenous lectin widely expressed at sites of inflammation and tumour growth, has been postulated as an attractive immunosuppressive agent to restore immune cell tolerance and homeostasis in autoimmune and inflammatory settings. On the other hand, galectin-1 contributes to different steps of tumour progression including cell adhesion, migration and tumour-immune escape, suggesting that blockade of galectin-1 might result in therapeutic benefits in cancer. Several potential glycoprotein ligands for galectin-1 have been identified, including lysosome-associated membrane glycoproteins and fibronectin, laminin, as well as T-cell glycoproteins CD43 and CD45. Evidence points to Gal-1 and its ligands as one of the master regulators of such immune responses as T-cell homeostasis and survival, T-cell immune disorders, inflammation and allergies as well as host-pathogen interactions.

  • Gaudet AD, et al. (2005) Expression and functions of galectin-1 in sensory and motoneurons. Curr Drug Targets. 6(4): 419-25.
  • Kadoya T, et al. (2006) Structural and functional studies of galectin-1: a novel axonal regeneration-promoting activity for oxidized galectin-1. Curr Drug Targets. 6(4): 375-83.
  • Camby I, et al. (2006) Galectin-1: a small protein with major functions. Glycobiology. 16(11): 137R-157R.
  • Salatino M, et al. (2008) Galectin-1 as a potential therapeutic target in autoimmune disorders and cancer. Expert Opin Biol Ther. 8(1): 45-57.
  • Size / Price
    Каталог: CG90161-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.