After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus LAYN Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001105766.2
Размер кДНК:1125bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) layilin with C terminal Flag tag.
Синоним гена:LAYN
Виды:Rhesus
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90160-ACGRBS15400
Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90160-ACRRBS15400
Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90160-CFRBS13340
Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90160-CHRBS13340
Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90160-CMRBS13340
Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90160-CYRBS13340
Резус-фактор Layilin / LAYN Джин клон кДНК в вектор клонированияCG90160-GRBS5130
Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90160-NFRBS13340
Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90160-NHRBS13340
Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90160-NMRBS13340
Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90160-NYRBS13340
Резус-фактор Layilin / LAYN Джин ORF экспрессии кДНК клона плазмидыCG90160-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Layilin, a recently characterized as a 55 kDa transmembrane protein with homology to C-type lectins, is present in numerous cell lines and tissue extracts. As one of the adaptor proteins, talin mediates the interactions between the actin filaments and the cell membrane by binding to integral membrane proteins and to the cytoskeleton. Layilin is a newly identified membrane-binding site for talin in peripheral ruffles of spreading cells, a ten-amino acid motif in the layilin cytoplasmic domain is sufficient for talin binding, and its adjacent LH2-LH3 tandem arrays in the cytoplasmic domain provide docking sites for talin. Furthermore, talin binds layilin, PIPK1gamma and integrins in similar although subtly different ways. Layilin binds specifically to hyaluronan (HA) through its extracellular domain, a ubiquitous extracellular matrix component in most animal tissues and body fluids, but not to other tested glycosaminoglycans. The research suggests that layilin may mediate signals from extracellular matrix to the cell cytoskeleton via interaction with different intracellular binding partners and thereby be involved in the modulation of cortical structures in the cell. All the above actions reveal an interesting parallel between layilin and the known HA receptor CD44. In addition, merlin and radixin have been identified as different intracellular binding partners of layilin. Accordingly, it has been suggested that layilin plays roles in a variety of cellular processes, including cell shape, adhesion, motility, and homeostasis, as well as signal transduction. In addition, layilin might play an important role in the process of invasion and lymphatic metastasis of lung carcinoma.

Ссылки
  • Borowsky ML, et al. (1998) Layilin, a novel talin-binding transmembrane protein homologous with C-type lectins, is localized in membrane ruffles.J Cell Biol. 143(2):429-42.
  • Bono P, et al. (2001) Layilin, a novel integral membrane protein, is a hyaluronan receptor. Mol Biol Cell. 12(4)891-900.
  • Bono P, et al. (2005) Layilin, a cell surface hyaluronan receptor, interacts with merlin and radixin. Exp Cell Res. 308(1):177-87.
  • Scoles DR. (2007) The merlin interacting proteins reveal multiple targets for NF2 therapy. Biochim Biophys Acta. 1785(1):32-54.
  • Chen Z, et al. (2008) Down-regulation of layilin, a novel hyaluronan receptor, via RNA interference, inhibits invasion and lymphatic metastasis of human lung A549 cells. Biotechnol Appl Biochem. 50(Pt 2):89-96.
  • Wegener KL, et al. (2008) Structural basis for the interaction between the cytoplasmic domain of the hyaluronate receptor layilin and the talin F3 subdomain. J Mol Biol. 382(1):112-26.
  • Size / Price
    Каталог: CG90160-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».