Быстрый заказ

Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus KLRK1 Информация о продукте «Клон cDNA»
Размер кДНК:651bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) NKG2D protein with C terminal Flag tag.
Синоним гена:KLRK1, NKG2-D, NKG2D
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90164-ACGRBS15400
Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90164-ACRRBS15400
Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90164-CFRBS13340
Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90164-CHRBS13340
Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90164-CMRBS13340
Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90164-CYRBS13340
Резус-фактор NKG2D/CD314/KLRK1 Джин клон кДНК в вектор клонированияCG90164-GRBS5130
Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90164-NFRBS13340
Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90164-NHRBS13340
Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90164-NMRBS13340
Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90164-NYRBS13340
Резус-фактор NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмидыCG90164-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

NKG2D, also known as CD314, is an immune receptor which consists of two disulphide-linked type II transmembrane proteins with short intracellular proteins uncapable to transduce signals. In order to transduce signals, NKG2D needs adaptor proteins and it uses two adaptor proteins, DAP10 and DAP12. These two adaptor proteins associate as homodimers to NKG2D- therefore the entire receptor complex appears as a hexamer. NKG2D can send co-stimulatory signals to activate CD8 T cells. NKG2D also plays an important role in viral control. Cellular stress can induce ligands for NKG2D which results in the cell susceptible to NK cell-mediated lysis.

  • Houchins J, et al. (1991) DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. J Exp Med. 173: 1017-102.
  • Bauer S, et al. (1999) Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 285(5428):727-9.
  • Zafirova B, et al. (2011) Regulation of immune cell function and differentiation by the NKG2D receptor. Cell Mol Life Sci. 68(21):3519-29.
  • Size / Price
    Каталог: CG90164-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.