KLRF1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Price:
Size:
Number:

KLRF1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
696 bp
Description
Full length Clone DNA of Rhesus killer cell lectin-like receptor subfamily F, member 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

KLRF1 Background Information

NKp8, also known as KLRF1, is an activating homodimeric C-type lectin-like receptor which is expressed on nearly all natural killer cells and stimulates their cytoxicity and cytokine release. NKp8 stimulates cytotoxicity upon engagement of its genetically linked ligand: myeloid-specific CTLR activation-induced C-type lectin (AICL). NKp8, but not NKp8 mutated at tyrosine 7 (NKp8/Y7F), is tyrosine phosphorylated. Accordingly, NKp8/Y7F, but not NKp8/Y3F or NKp8/Y37F, failed to induce cytotoxicity. NKp8 phosphopeptides comprising the hemi-ITAM-like sequence surrounding tyrosine 7 bound Lck- and Syk-family kinases; accordingly, cross-linking of NKp8, but not NKp8/Y7F, induced Syk phosphorylation. Moreover, inhibition of Syk kinase, but not ZAP-7 kinase, impaired cytotoxic responses through NKp8. Atypical residues in the hemi-ITAM-like motif of NKp8 cause an altered stoichiometry of phosphorylation but did not substantially affect NK cytotoxicity. Altogether, these results show that NKp8 uses an atypical hemi-ITAM and Syk kinase to trigger cellular cytotoxicity.
Full Name
killer cell lectin like receptor F1
References
  • Kuttruff S. et al., 2009, Blood. 113 (2): 358-69.
  • Dennehy KM. et al., 2011, J Immunol. 186 (2): 657-61.
  • Roda-Navarro P. et al., 2000, Eur J Immunol. 30 (2): 568-76.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait