After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus KLRF1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001032961.1
Размер кДНК:696bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) killer cell lectin-like receptor subfamily F, member 1 with C terminal Flag tag.
Синоним гена:KLRF1
Виды:Rhesus
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90165-ACGRBS15396
Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90165-ACRRBS15396
Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90165-CFRBS13343
Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90165-CHRBS13343
Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90165-CMRBS13343
Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90165-CYRBS13343
Резус-фактор NKp80 / KLRF1 Джин клон кДНК в вектор клонированияCG90165-GRBS5132
Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90165-NFRBS13343
Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90165-NHRBS13343
Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90165-NMRBS13343
Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90165-NYRBS13343
Резус-фактор NKp80 / KLRF1 Джин ORF экспрессии кДНК клона плазмидыCG90165-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

NKp80, also known as KLRF1, is an activating homodimeric C-type lectin-like receptor which is expressed on nearly all natural killer cells and stimulates their cytoxicity and cytokine release. NKp80 stimulates cytotoxicity upon engagement of its genetically linked ligand: myeloid-specific CTLR activation-induced C-type lectin (AICL). NKp80, but not NKp80 mutated at tyrosine 7 (NKp80/Y7F), is tyrosine phosphorylated. Accordingly, NKp80/Y7F, but not NKp80/Y30F or NKp80/Y37F, failed to induce cytotoxicity. NKp80 phosphopeptides comprising the hemi-ITAM-like sequence surrounding tyrosine 7 bound Lck- and Syk-family kinases; accordingly, cross-linking of NKp80, but not NKp80/Y7F, induced Syk phosphorylation. Moreover, inhibition of Syk kinase, but not ZAP-70 kinase, impaired cytotoxic responses through NKp80. Atypical residues in the hemi-ITAM-like motif of NKp80 cause an altered stoichiometry of phosphorylation but did not substantially affect NK cytotoxicity. Altogether, these results show that NKp80 uses an atypical hemi-ITAM and Syk kinase to trigger cellular cytotoxicity.

Ссылки
  • Kuttruff S. et al., 2009, Blood. 113 (2): 358-69.
  • Dennehy KM. et al., 2011, J Immunol. 186 (2): 657-61.
  • Roda-Navarro P. et al., 2000, Eur J Immunol. 30 (2): 568-76.
  • Size / Price
    Каталог: CG90165-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».