After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus KLHL23 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001260558.2
Размер кДНК:1677bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) kelch-like 23 (Drosophila) with C terminal His tag.
Синоним гена:KLHL23
Виды:Rhesus
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90826-ACGRBS16760
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90826-ACRRBS16760
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90826-ANGRBS16760
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90826-ANRRBS16760
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90826-CFRBS14710
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90826-CHRBS14710
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90826-CMRBS14710
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90826-CYRBS14710
Резус-фактор KLHL23 Джин клон кДНК в вектор клонированияCG90826-GRBS5130
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90826-NFRBS14710
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90826-NHRBS14710
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90826-NMRBS14710
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90826-NYRBS14710
Резус-фактор KLHL23 Джин ORF экспрессии кДНК клона плазмидыCG90826-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90826-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».