After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus KCNAB1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001260716.2
Размер кДНК:1206bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) potassium voltage-gated channel, shaker-related subfamily, beta member 1.
Синоним гена:KCNAB1
Виды:Rhesus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90736-ACGRBS15400
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90736-ACRRBS15400
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90736-ANGRBS15400
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90736-ANRRBS15400
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90736-CFRBS13340
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90736-CHRBS13340
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90736-CMRBS13340
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90736-CYRBS13340
Резус-фактор Kv beta 1/KCNAB1 Джин клон кДНК в вектор клонированияCG90736-GRBS5130
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90736-NFRBS13340
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90736-NHRBS13340
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90736-NMRBS13340
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90736-NYRBS13340
Резус-фактор Kv beta 1/KCNAB1 Джин ORF экспрессии кДНК клона плазмидыCG90736-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90736-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».