LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90646-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All LysRS/Lysyl tRNA synthetase Reagents

CRO Services

Product recommended


All LysRS/Lysyl tRNA synthetase Reagents

LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, N-Myc tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1878 bp
Description
Full length Clone DNA of Rhesus lysyl-tRNA synthetase with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LysRS/Lysyl tRNA synthetase Background Information

Full Name
lysyl-tRNA synthetase

LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
LysRS/Lysyl tRNA synthetase cDNA ORF Clone in Cloning Vector, Rhesus CG90646-G
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, untagged CG90646-UT
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90646-ACG
LysRS/Lysyl tRNA synthetase Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90646-ACGLN
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90646-ANG
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90646-ACR
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90646-ANR
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90646-CF
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90646-NF
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, C-His tag CG90646-CH
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, N-His tag CG90646-NH
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, C-HA tag CG90646-CY
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, N-HA tag CG90646-NY
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rhesus, C-Myc tag CG90646-CM

LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LysRS/Lysyl tRNA synthetase cDNA ORF Clone in Cloning Vector, Rat RG81214-U
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, untagged RG81214-UT
LysRS/Lysyl tRNA synthetase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81214-ACGLN
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, C-GFPSpark® tag RG81214-ACG
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, N-GFPSpark® tag RG81214-ANG
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, C-OFPSpark® tag RG81214-ACR
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, N-OFPSpark® tag RG81214-ANR
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81214-CF
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81214-NF
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, C-His tag RG81214-CH
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, N-His tag RG81214-NH
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, C-HA tag RG81214-CY
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, N-HA tag RG81214-NY
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, C-Myc tag RG81214-CM
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Rat, N-Myc tag RG81214-NM
LysRS/Lysyl tRNA synthetase qPCR Primer Pairs, Rat RP301170

LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LysRS/Lysyl tRNA synthetase cDNA ORF Clone in Cloning Vector, Mouse MG53008-G
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, untagged MG53008-UT
LysRS/Lysyl tRNA synthetase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53008-ACGLN
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53008-ACG
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53008-ACR
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53008-CF
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53008-NF
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, C-His tag MG53008-CH
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, N-His tag MG53008-NH
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, C-HA tag MG53008-CY
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, N-HA tag MG53008-NY
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, C-Myc tag MG53008-CM
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Mouse, N-Myc tag MG53008-NM

LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LysRS/Lysyl tRNA synthetase cDNA ORF Clone in Cloning Vector, Human HG14355-G
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, untagged HG14355-UT
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, C-GFPSpark® tag HG14355-ACG
LysRS/Lysyl tRNA synthetase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14355-ACGLN
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, N-GFPSpark® tag HG14355-ANG
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, C-OFPSpark® tag HG14355-ACR
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, N-OFPSpark® tag HG14355-ANR
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14355-CF
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14355-NF
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, C-His tag HG14355-CH
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, N-His tag HG14355-NH
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, C-HA tag HG14355-CY
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, N-HA tag HG14355-NY
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, C-Myc tag HG14355-CM
LysRS/Lysyl tRNA synthetase cDNA ORF Clone, Human, N-Myc tag HG14355-NM
LysRS/Lysyl tRNA synthetase qPCR Primer Pairs, Human HP103004
info info
添加购物车成功! 添加购物车失败!