After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus IL1B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001042756.1
Размер кДНК:810bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interleukin 1, beta with N terminal Myc tag.
Синоним гена:IL1B
Виды:Rhesus
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90010-ACGRBS15400
Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90010-ACRRBS15400
Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90010-CFRBS13340
Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90010-CHRBS13340
Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90010-CMRBS13340
Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90010-CYRBS13340
Резус-фактор IL1B/IL-1B/IL-1 beta Джин клон кДНК в вектор клонированияCG90010-MRBS5130
Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90010-NFRBS13340
Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90010-NHRBS13340
Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90010-NMRBS13340
Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90010-NYRBS13340
Резус-фактор IL1B/IL-1B/IL-1 beta Джин ORF экспрессии кДНК клона плазмидыCG90010-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin-1 beta (IL1 beta or IL1B) also known as catabolin, is a member of the interleukin 1 cytokine family. IL1 is a pleiotropic cytokine. It is involved in the inflammatory response, cell growth, and tissue repair in the cortex. The IL1 superfamily consists of three members, IL1A (IL1 alpha), IL1B (IL1 beta), and IL1 receptor antagonist (IL1Ra). In clinical, it has been reported that Interleukin (IL)-1 may influence Th1 / Th2 immune responsiveness and has been implicated in the establishment of successful pregnancy. Proinflammatory interleukin (IL)-1 gene polymorphisms associated with high levels of IL-1beta activity increase the risk for hypochlorhydria and distal gastric carcinoma. IL1B polymorphisms may be involved in susceptibility to SSc. Moreover, the IL2-384-G allele may be a marker for the limited phenotype of systemic sclerosis (SSc).

Ссылки
  • Kim SH, et al. (2008) Association of -31TC and -511 CT polymorphisms in the interleukin 1 beta (IL1B) promoter in Korean keratoconus patients. Mol Vis. 14:2109-16.
  • Wang ZC, et al. (2002) T helper 1-type immunity to trophoblast antigens in women with a history of recurrent pregnancy loss is associated with polymorphism of the IL1B promoter region. Genes Immun. 3(1): 38-42.
  • Mattuzzi S, et al. (2007) Association of polymorphisms in the IL1B and IL2 genes with susceptibility and severity of systemic sclerosis. J Rheumatol. 34(5): 997-1004.
  • Size / Price
    Каталог: CG90010-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».