After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus IGSF8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005541281.1
Размер кДНК:1845bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) immunoglobulin superfamily, member 8.
Синоним гена:IGSF8
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90732-ACGRBS16760
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90732-ACRRBS16760
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90732-CFRBS14710
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90732-CHRBS14710
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90732-CMRBS14710
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90732-CYRBS14710
Яванский макак IGSF8 Джин клон кДНК в вектор клонированияCG90732-GRBS5130
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90732-NFRBS14710
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90732-NHRBS14710
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90732-NMRBS14710
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90732-NYRBS14710
Яванский макак IGSF8 Джин ORF экспрессии кДНК клона плазмидыCG90732-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Glazar AI, et al. (2009) Immunoglobulin superfamily member IgSF8 (EWI-2) and CD9 in fertilisation: evidence of distinct functions for CD9 and a CD9-associated protein in mammalian sperm-egg interaction. Reprod Fertil Dev. 21(2): 293-303.
  • Murdoch JN, et al. (2003) Genomic organization and embryonic expression of Igsf8, an immunoglobulin superfamily member implicated in development of the nervous system and organ epithelia. Mol Cell Neurosci. 22(1): 62-74.
  • Zhang XA, et al. (2003) EWI2/PGRL associates with the metastasis suppressor KAI1/CD82 and inhibits the migration of prostate cancer cells. Cancer Res. 63 (10): 2665-74.
  • Size / Price
    Каталог: CG90732-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».