Быстрый заказ

Text Size:AAA

Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus IFNG Информация о продукте «Клон cDNA»
Размер кДНК:498bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interferon-gamma with N terminal Myc tag.
Синоним гена:IFN-gamma, IFNG
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90008-ACGRBS15400
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90008-ACRRBS15400
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90008-CFRBS13340
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90008-CHRBS13340
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90008-CMRBS13340
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90008-CYRBS13340
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин клон кДНК в вектор клонированияCG90008-MRBS5130
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90008-NFRBS13340
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90008-NHRBS13340
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90008-NMRBS13340
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90008-NYRBS13340
Резус-фактор Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмидыCG90008-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Каталог: CG90008-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.