Быстрый заказ

Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus HSP90AA1 Информация о продукте «Клон cDNA»
Размер кДНК:2202bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) heat shock protein 90kDa alpha (cytosolic), class A member 1 with C terminal HA tag.
Синоним гена:HSP90AA1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90401-ACGRBS16760
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90401-ACRRBS16760
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90401-ANGRBS16760
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90401-ANRRBS16760
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90401-CFRBS14710
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90401-CHRBS14710
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90401-CMRBS14710
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90401-CYRBS14710
Резус-фактор HSP90/HSP90AA1 Джин клон кДНК в вектор клонированияCG90401-GRBS5130
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90401-NFRBS14710
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90401-NHRBS14710
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90401-NMRBS14710
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90401-NYRBS14710
Резус-фактор HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмидыCG90401-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Heat shock protein 90 (90 kDa heat-shock protein, HSP90) is a molecular chaperone involved in the trafficking of proteins in the cell. It is a remarkably versatile protein involved in the stress response and in normal homoeostatic control mechanisms. HSP90 interacts with 'client proteins', including protein kinases, transcription factors and others, and either facilitates their stabilization and activation or directs them for proteasomal degradation. By this means, HSP90 displays a multifaceted ability to influence signal transduction, chromatin remodelling and epigenetic regulation, development and morphological evolution. HSP90 operates as a dimer in a conformational cycle driven by ATP binding and hydrolysis at the N-terminus. Disruption of HSP90 leads to client protein degradation and often cell death. Under stressful conditions, HSP90 stabilizes its client proteins and provides protection to the cell against cellular stressors such as in cancer cells. Especially, several oncoproteins act as HSP90 client proteins and tumor cells require higher HSP90 activity than normal cells to maintain their malignancy. For this reason, Hsp90 has emerged as a promising target for anti-cancer drug development.

  • Pearl LH, et al. (2008) The Hsp90 molecular chaperone: an open and shut case for treatment. Biochem J. 410(3): 439-53.
  • Hahn JS. (2009) The Hsp90 chaperone machinery: from structure to drug development. BMB Rep. 42(10): 623-30.
  • Holzbeierlein JM, et al. (2010) Hsp90: a drug target? Curr Oncol Rep. 12(2): 95-101.
  • Trepel J, et al. (2010) Targeting the dynamic HSP90 complex in cancer. Nat Rev Cancer. 10(8): 537-49.
  • Size / Price
    Каталог: CG90401-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.