After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus HDGF Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005541407.1
Размер кДНК:723bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) hepatoma-derived growth factor with N terminal Myc tag.
Синоним гена:HDGF
Виды:Cynomolgus
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90670-ACGRBS15400
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90670-ACRRBS15400
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90670-ANGRBS15400
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90670-ANRRBS15400
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90670-CFRBS13340
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90670-CHRBS13340
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90670-CMRBS13340
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90670-CYRBS13340
Яванский макак HDGF Джин клон кДНК в вектор клонированияCG90670-GRBS5130
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90670-NFRBS13340
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90670-NHRBS13340
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90670-NMRBS13340
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90670-NYRBS13340
Яванский макак HDGF Джин ORF экспрессии кДНК клона плазмидыCG90670-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90670-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».