Быстрый заказ

Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак H2AFZ Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001193550.1
    Размер кДНК:387bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) H2A histone family, member Z with N terminal HA tag.
    Синоним гена:H2AFZ
    Виды:Rhesus
    переносчик:pCMV3-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90418-ACGRBS15400
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90418-ACRRBS15400
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90418-ANGRBS15400
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90418-ANRRBS15400
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90418-CFRBS13340
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90418-CHRBS13340
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90418-CMRBS13340
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90418-CYRBS13340
    Резус-фактор H2AFZ Джин клон кДНК в вектор клонированияCG90418-GRBS5130
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90418-NFRBS13340
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90418-NHRBS13340
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90418-NMRBS13340
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90418-NYRBS13340
    Резус-фактор H2AFZ Джин ORF экспрессии кДНК клона плазмидыCG90418-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90418-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».